Skip to main content

pN3-sTRAIL
(Plasmid #154246)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154246 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pN3 Control
  • Backbone size w/o insert (bp) 3974
  • Total vector size (bp) 5147
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Secretable Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand
  • Alt name
    sTRAIL
  • Species
    H. sapiens (human)
  • Promoter CMV Promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer AGAGCTGGTTTAGTGAACCG
  • 3′ sequencing primer GAATTCGAAGCTTGAGCTCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pN3-sTRAIL was a gift from Jordan Green (Addgene plasmid # 154246 ; http://n2t.net/addgene:154246 ; RRID:Addgene_154246)
  • For your References section:

    Poly(beta-amino ester) nanoparticles enable tumor-specific TRAIL secretion and a bystander effect to treat liver cancer. Vaughan HJ, Zamboni CG, Radant NP, Bhardwaj P, Revai Lechtich E, Hassan LF, Shah K, Green JJ. Mol Ther Oncolytics. 2021 Apr 16;21:377-388. doi: 10.1016/j.omto.2021.04.004. eCollection 2021 Jun 25. 10.1016/j.omto.2021.04.004 PubMed 34189258