pN3-sTRAIL
(Plasmid
#154246)
-
PurposePlasmid compatible with non-viral delivery for secretion of trimeric human TRAIL
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154246 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepN3 Control
- Backbone size w/o insert (bp) 3974
- Total vector size (bp) 5147
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSecretable Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand
-
Alt namesTRAIL
-
SpeciesH. sapiens (human)
- Promoter CMV Promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer AGAGCTGGTTTAGTGAACCG
- 3′ sequencing primer GAATTCGAAGCTTGAGCTCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pN3-sTRAIL was a gift from Jordan Green (Addgene plasmid # 154246 ; http://n2t.net/addgene:154246 ; RRID:Addgene_154246) -
For your References section:
Poly(beta-amino ester) nanoparticles enable tumor-specific TRAIL secretion and a bystander effect to treat liver cancer. Vaughan HJ, Zamboni CG, Radant NP, Bhardwaj P, Revai Lechtich E, Hassan LF, Shah K, Green JJ. Mol Ther Oncolytics. 2021 Apr 16;21:377-388. doi: 10.1016/j.omto.2021.04.004. eCollection 2021 Jun 25. 10.1016/j.omto.2021.04.004 PubMed 34189258