pEF1α-pygmy-marmoset-retroCHMP3(148)-HA
(Plasmid
#154251)
-
Purposeexpresses prematurely truncated pygmy marmoset retroCHMP3 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154251 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEF-GFP
-
Backbone manufacturer#11154
- Backbone size w/o insert (bp) 4311
- Total vector size (bp) 4808
-
Modifications to backbonedeleted GFP
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameretroCHMP3
-
SpeciesCallithrix pygmaea (pygmy marmoset)
-
Insert Size (bp)497
-
MutationC-terminal truncation of retroCHMP3 at amino acid 148
- Promoter EF1-alpha
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ggaatttgccctttttgagtttgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDiane Downhour, Nels Elde laboratory, University of Utah
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF1α-pygmy-marmoset-retroCHMP3(148)-HA was a gift from Wesley Sundquist (Addgene plasmid # 154251 ; http://n2t.net/addgene:154251 ; RRID:Addgene_154251) -
For your References section:
Recurrent evolution of an inhibitor of ESCRT-dependent virus budding and LINE-1 retrotransposition in primates. Rheinemann L, Downhour DM, Davenport KA, McKeown AN, Sundquist WI, Elde NC. Curr Biol. 2022 Feb 25. pii: S0960-9822(22)00240-8. doi: 10.1016/j.cub.2022.02.018. 10.1016/j.cub.2022.02.018 PubMed 35245459