pJW2088
(Plasmid #154336)

Purpose

Crispr repair template: add insertion site specific homology arms by PCR before insertion
Depositing Lab

Jordan Ward
Publication

Ashley et al Genetics, 2021 ( How to cite )
Sequence Information
- Sequences (2)

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	154336	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart

This material is available to academics and nonprofits only.

Backbone

Vector backbone
pDONR221
(Search Vector Database)
Backbone size w/o insert (bp) 2360
Vector type
Worm Expression, CRISPR

Growth in Bacteria

Bacterial Resistance(s)
Kanamycin, 50 μg/mL
Growth Temperature
37°C
Growth Strain(s)
DH5alpha
Copy number
High Copy

Gene/Insert

Gene/Insert name
30aa linker::GFP::3xFLAG::10aa linker
Species
C. elegans (nematode), Synthetic
Insert Size (bp)
1692

Cloning Information

Cloning method Gibson Cloning
5′ sequencing primer M13 Forward (tgtaaaacgacggccagt)
3′ sequencing primer M13 Reverse (caggaaacagctatgaccatg)

(Common Sequencing Primers)

Resource Information

Supplemental Documents
- pJW2088.gb

Terms and Licenses

Academic/Nonprofit Terms
- UBMTA
- Ancillary Agreement for Plasmids Containing FP Materials
Industry Terms
- Not Available to Industry

Trademarks:

Zeocin® is an InvivoGen trademark.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

For your Materials & Methods section:

pJW2088 was a gift from Jordan Ward (Addgene plasmid # 154336 ; http://n2t.net/addgene:154336 ; RRID:Addgene_154336)
For your References section:

An expanded auxin-inducible degron toolkit for Caenorhabditis elegans. Ashley G, Duong T, Levenson MT, Martinez MAQ, Johnsen LC, Hibshman JD, Saeger HN, Palmisano NJ, Doonan R, Martinez-Mendez R, Davidson B, Zhang W, Ragle JM, Medwig-Kinney TN, Sirota SS, Goldstein B, Matus DQ, Dickinson DJ, Reiner DJ, Ward JD. Genetics, 2021 10.1093/genetics/iyab006

pJW2088 (Plasmid #154336)