-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 15474 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepKmyc
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePartitioning-defective protein 6C
-
Alt namePar6C
-
Alt namePAR-6C
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1037
-
GenBank IDAF252292
-
Entrez GenePARD6A (a.k.a. PAR-6A, PAR6, PAR6C, PAR6alpha, TAX40, TIP-40)
-
Tag
/ Fusion Protein
- Myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer CAGGTCCAACTGCACCTCGGTTC
- 3′ sequencing primer TTTGTGATGCTATTGCTTTATTTG TA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pK-myc-Par6C was a gift from Ian Macara (Addgene plasmid # 15474 ; http://n2t.net/addgene:15474 ; RRID:Addgene_15474) -
For your References section:
The cell-polarity protein Par6 links Par3 and atypical protein kinase C to Cdc42. Joberty G, Petersen C, Gao L, Macara IG. Nat Cell Biol 2000 Aug;2(8):531-9. 10.1038/35019573 PubMed 10934474