Skip to main content
Addgene

pRG714_lexO-AscI_LexA-TF_URA3MX
(Plasmid #154822)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154822 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRG206MX
  • Backbone manufacturer
    Addgene plasmid # 64536
  • Backbone size w/o insert (bp) 4434
  • Total vector size (bp) 9400
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    AscI endonuclease
  • Alt name
    ascIR
  • Species
    Arthrobacter sp. NEB 688
  • Insert Size (bp)
    2117
  • Promoter lexO_4-CYC1_core
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • FLAG (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site KpnI (non-unique) (not destroyed)
  • 5′ sequencing primer T7 TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    LexA-ER-B112
  • Species
    Synthetic
  • Insert Size (bp)
    2926
  • Promoter ACT1

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (non-unique) (not destroyed)
  • 3′ cloning site KpnI (non-unique) (not destroyed)
  • 5′ sequencing primer ACT1 Promoter Forward TATTTCTCTGTCACCCGGCC
  • 3′ sequencing primer M13 Reverse CAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    LexA TF from FRP880 (Addgene plasmid # 58437).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Linearize plasmid with AscI for integration into the yeast genome. See Gnuegge et al., 2016 (https://pubmed.ncbi.nlm.nih.gov/26647923/) for details.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRG714_lexO-AscI_LexA-TF_URA3MX was a gift from Lorraine Symington (Addgene plasmid # 154822 ; http://n2t.net/addgene:154822 ; RRID:Addgene_154822)
  • For your References section:

    Efficient DNA double-strand break formation at single or multiple defined sites in the Saccharomyces cerevisiae genome. Gnugge R, Symington LS. Nucleic Acids Res. 2020 Oct 14. pii: 5923424. doi: 10.1093/nar/gkaa833. 10.1093/nar/gkaa833 PubMed 33053188