pCW-codon optimized catalytically inactive PHGDH
(Plasmid #154903)

• Purpose: Expresses codon optimized catalytically inactive PHGDH in mammalian cells
• Depositing Lab: Michael Pacold
• Publication: Ngo et al Cancer Discov. 2020 Sep;10(9):1352-1373. doi: 10.1158/2159-8290.CD-19-1228. Epub 2020 Jun 22.

Backbone

• Vector backbone: pCW57-MCS1-P2A-MCS2
• Backbone size w/o insert (bp): 7943
• Total vector size (bp): 9500
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Phosphoglycerate dehydrogenase
• Alt name: 3-phosphoglycerate dehydrogenase
• Alt name: PHGDH
• Species: H. sapiens (human)
• Insert Size (bp): 1629
• Mutation: Three mutations: D175N, R236K, H283A
• GenBank ID: NM_006623.4
• Entrez Gene: PHGDH (a.k.a. 3-PGDH, 3PGDH, HEL-S-113, NLS, NLS1, PDG, PGAD, PGD, PGDH, PHGDHD, SERA)
• Promoter: TRE

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (unknown if destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: AGCTCGTTTAGTGAACCGTCAGATC
• 3′ sequencing primer: GAACGGACGTGAAGAATGTG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry