pMXS-IRES-BLAST PHGDH
(Plasmid
#154917)
-
PurposeExpresses human PHGDH
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154917 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMXS-IRES-BLAST
- Backbone size w/o insert (bp) 5600
- Total vector size (bp) 7200
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePHGDH
-
Alt name3PGDH, 3 phosphoglycerate dehydrogenase
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1600
-
GenBank IDNM_006623.4
-
Entrez GenePHGDH (a.k.a. 3-PGDH, 3PGDH, HEL-S-113, NLS, NLS1, PDG, PGAD, PGD, PGDH, PHGDHD, SERA)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (destroyed during cloning)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer AGTAGACGGCATCGCAGCTTGGATA
- 3′ sequencing primer CGGCCTTATTCCAAGCGGCTTCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXS-IRES-BLAST PHGDH was a gift from Richard Possemato (Addgene plasmid # 154917 ; http://n2t.net/addgene:154917 ; RRID:Addgene_154917) -
For your References section:
Richard Possemato Lab plasmids. Richard Possemato. Richard Possemato Lab plasmids PubMed 32446203