pEM-Cas9HF1-D1135E
(Plasmid
#154924)
-
PurposeaTc inducible Cas9HF1 with D1135E mutation
-
Depositing Lab
-
Depositing OrganizationDuke University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154924 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonep15A
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCas9HF1-D1135E
-
Insert Size (bp)4104
-
MutationN497A/R661A/Q695A/Q926A/D1135E and stop codon on the Tet repressor (see depositor comments)
- Promoter pTet
-
Tag
/ Fusion Protein
- ssrA (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ccacaaagtttccttaaagacga
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene NGS had a stop codon on the Tet repressor. The depositing lab has not found that this difference impacts the function of the plasmid but it is possible that the expression of SpCas9HF1 is not well controlled by Tetracycline or its analogs.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEM-Cas9HF1-D1135E was a gift from Michael Lynch (Addgene plasmid # 154924 ; http://n2t.net/addgene:154924 ; RRID:Addgene_154924) -
For your References section:
CRISPR-Cas "Non-Target" Sites Inhibit On-Target Cutting Rates. Moreb EA, Hutmacher M, Lynch MD. CRISPR J. 2020 Dec;3(6):550-561. doi: 10.1089/crispr.2020.0065. 10.1089/crispr.2020.0065 PubMed 33346713