3xFLAG-CUL5-pCMV7.1
(Plasmid
#155024)
-
PurposeN-terminal 3xFLAG-tagged CUL5 in a pCMV7.1 vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 155024 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCMV7.1
- Backbone size w/o insert (bp) 4717
- Total vector size (bp) 11125
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCullin 5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)6408
-
GenBank IDNM_003478.3
-
Entrez GeneCUL5 (a.k.a. CUL-5, VACM-1, VACM1)
- Promoter pCMV7.1
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer AATGTCGTAATAACCCCGCCCCGTTGACGC
- 3′ sequencing primer CCTAGTCAGACAAAATGATGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
3xFLAG-CUL5-pCMV7.1 was a gift from Andre Catic (Addgene plasmid # 155024 ; http://n2t.net/addgene:155024 ; RRID:Addgene_155024) -
For your References section:
The ubiquitin ligase Cullin-1 associates with chromatin and regulates transcription of specific c-MYC target genes. Sweeney MA, Iakova P, Maneix L, Shih FY, Cho HE, Sahin E, Catic A. Sci Rep. 2020 Aug 18;10(1):13942. doi: 10.1038/s41598-020-70610-0. 10.1038/s41598-020-70610-0 PubMed 32811853