Skip to main content

pMC060-HisMS2_PLP_Env_pac
(Plasmid #155040)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 155040 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pMX
  • Backbone manufacturer
    Life Technologies
  • Backbone size w/o insert (bp) 2200
  • Total vector size (bp) 4839
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Maturation Protein
  • Alt name
    A-Protein
  • Species
    MS2 Phage
  • Insert Size (bp)
    1182
  • Mutation
    Remove TypeIIs Restriction Sites
  • GenBank ID
    ABQ02459
  • Promoter T7

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer gatgtgctgcaaggcgattaagttg
  • 3′ sequencing primer ctatggaaaaacgccagcaacg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Coat Protein Dimer
  • Species
    Synthetic
  • Insert Size (bp)
    801
  • Mutation
    Remove TypeIIs Restriction Sites
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer gatgtgctgcaaggcgattaagttg
  • 3′ sequencing primer ctatggaaaaacgccagcaacg
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Envelope Gene
  • Species
    SARS-CoV-2
  • Insert Size (bp)
    228
  • GenBank ID
    NC_045512
  • Promoter T7

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp3I (BsmBI) (destroyed during cloning)
  • 3′ cloning site Esp3I (BsmBI) (destroyed during cloning)
  • 5′ sequencing primer gacggtctcgcatcgaacagaaagtaatcgtattg
  • 3′ sequencing primer ctatggaaaaacgccagcaacg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMC060-HisMS2_PLP_Env_pac was a gift from Paul Freemont (Addgene plasmid # 155040 ; http://n2t.net/addgene:155040 ; RRID:Addgene_155040)
  • For your References section:

    A role for Biofoundries in rapid development and validation of automated SARS-CoV-2 clinical diagnostics. Crone MA, Priestman M, Ciechonska M, Jensen K, Sharp DJ, Anand A, Randell P, Storch M, Freemont PS. Nat Commun. 2020 Sep 8;11(1):4464. doi: 10.1038/s41467-020-18130-3. 10.1038/s41467-020-18130-3 PubMed 32900994