pMC060-HisMS2_PLP_Env_pac
(Plasmid
#155040)
-
PurposeGeneration of MS2 Virus Like Particles packaged with the sequence for the SARS-CoV-2 Envelope Gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 155040 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepMX
-
Backbone manufacturerLife Technologies
- Backbone size w/o insert (bp) 2200
- Total vector size (bp) 4839
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameMaturation Protein
-
Alt nameA-Protein
-
SpeciesMS2 Phage
-
Insert Size (bp)1182
-
MutationRemove TypeIIs Restriction Sites
-
GenBank IDABQ02459
- Promoter T7
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer gatgtgctgcaaggcgattaagttg
- 3′ sequencing primer ctatggaaaaacgccagcaacg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCoat Protein Dimer
-
SpeciesSynthetic
-
Insert Size (bp)801
-
MutationRemove TypeIIs Restriction Sites
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer gatgtgctgcaaggcgattaagttg
- 3′ sequencing primer ctatggaaaaacgccagcaacg
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameEnvelope Gene
-
SpeciesSARS-CoV-2
-
Insert Size (bp)228
-
GenBank IDNC_045512
- Promoter T7
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site Esp3I (BsmBI) (destroyed during cloning)
- 3′ cloning site Esp3I (BsmBI) (destroyed during cloning)
- 5′ sequencing primer gacggtctcgcatcgaacagaaagtaatcgtattg
- 3′ sequencing primer ctatggaaaaacgccagcaacg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMC060-HisMS2_PLP_Env_pac was a gift from Paul Freemont (Addgene plasmid # 155040 ; http://n2t.net/addgene:155040 ; RRID:Addgene_155040) -
For your References section:
A role for Biofoundries in rapid development and validation of automated SARS-CoV-2 clinical diagnostics. Crone MA, Priestman M, Ciechonska M, Jensen K, Sharp DJ, Anand A, Randell P, Storch M, Freemont PS. Nat Commun. 2020 Sep 8;11(1):4464. doi: 10.1038/s41467-020-18130-3. 10.1038/s41467-020-18130-3 PubMed 32900994