plenti-As-Cas12a-2xNLS
(Plasmid
#155047)
-
PurposeLentiviral vector expressing human codon-optimized _C-terminal Myc-tagged _Acidaminococcus sp. BV3L6 (As)-Cas12a nuclease with N- and C-terminal NLS and Neomycin/G418/Geneticin resistance from EF-1alpha promoter
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 155047 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelenti CRISPR pXPR_001/Lenti_Cas9_2A_Blast (Addgene plasmid #73310)
- Backbone size w/o insert (bp) 7368
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAsCas12a
-
SpeciesAcidaminococcus sp. BV3L6
-
Insert Size (bp)4065
- Promoter EF-1a
-
Tags
/ Fusion Proteins
- SV40 NLS (N terminal on insert)
- Nucleoplasmin NLS, Myc-tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer GGGTGGGGGAGAACCGTATA
- 3′ sequencing primer TGGGCCAGGATTCTCCTCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The NeoR/KanR cassette contains S177R and E182D mismatches compared to the reference sequence. The depositing lab does not believe these are of functional concern but the construct should be functionally validated prior to experimentation.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
plenti-As-Cas12a-2xNLS was a gift from Benjamin Blencowe & Jason Moffat (Addgene plasmid # 155047 ; http://n2t.net/addgene:155047 ; RRID:Addgene_155047) -
For your References section:
Genetic interaction mapping and exon-resolution functional genomics with a hybrid Cas9-Cas12a platform. Gonatopoulos-Pournatzis T, Aregger M, Brown KR, Farhangmehr S, Braunschweig U, Ward HN, Ha KCH, Weiss A, Billmann M, Durbic T, Myers CL, Blencowe BJ, Moffat J. Nat Biotechnol. 2020 May;38(5):638-648. doi: 10.1038/s41587-020-0437-z. Epub 2020 Mar 16. 10.1038/s41587-020-0437-z PubMed 32249828