pLCHKO_HPRT1_exon2_1_Lb
(Plasmid
#155051)
-
PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases (CHyMErA system)
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 155051 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLCHKO
- Backbone size w/o insert (bp) 7481
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name(hg)RNA for deletion of HPRT1 exon 2
-
gRNA/shRNA sequenceGACTAAGACATATAGTTACAgtttcagagctatgctggaaacagcatagcaagttgaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctaatttctactaagtgtagatTTAAAAATAAAAGAGGAGGGCCT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)150
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BfuAI (destroyed during cloning)
- 3′ cloning site BfuAI (destroyed during cloning)
- 5′ sequencing primer actatcatatgcttaccgtaac (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
U6-driven hgRNA cassette encoded on anti-sense strand
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLCHKO_HPRT1_exon2_1_Lb was a gift from Benjamin Blencowe & Jason Moffat (Addgene plasmid # 155051 ; http://n2t.net/addgene:155051 ; RRID:Addgene_155051) -
For your References section:
Genetic interaction mapping and exon-resolution functional genomics with a hybrid Cas9-Cas12a platform. Gonatopoulos-Pournatzis T, Aregger M, Brown KR, Farhangmehr S, Braunschweig U, Ward HN, Ha KCH, Weiss A, Billmann M, Durbic T, Myers CL, Blencowe BJ, Moffat J. Nat Biotechnol. 2020 May;38(5):638-648. doi: 10.1038/s41587-020-0437-z. Epub 2020 Mar 16. 10.1038/s41587-020-0437-z PubMed 32249828