pTol2CG2-hsp70I:QFGal4-SV40pA
(Plasmid #155120)

• Purpose: Tol2 vector for heat-shock inducible expression of QFGal4. Contains cmlc2:mRFP-SV40pA transgenesis marker
• Depositing Lab: Bret Pearson
• Publication: Burgess et al Dev Biol. 2020 Jul 19. pii: S0012-1606(20)30202-5. doi: 10.1016/j.ydbio.2020.07.007.

Backbone

• Vector backbone: pDestTol2CG2 (Tol2 kit 1.0 #395)
• Backbone manufacturer: Esther Fujimoto, Chien lab
• Backbone size w/o insert (bp): 6251
• Total vector size (bp): 9298
• Modifications to backbone: cmlc2:GFP replaced with cmlc2:membrane-mRFP in reverse orientation
• Vector type: Zebrafish expression
• Selectable markers: cmlc2:mRFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hsp70l:QFGal4
• Species: D. rerio (zebrafish), S. cerevisiae (budding yeast); Neurospora crassa
• Insert Size (bp): 3047
• GenBank ID: 855828 3875756
• Entrez Gene: hsp70l (a.k.a. HSP70, hsp70-4)
• Promoter: hsp70l

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: gctgcaaatagcaggaaacg
• 3′ sequencing primer: GAGGATCATAATCAGCCATA

Resource Information

• Supplemental Documents:
  • pTol2CG2_hsp70l_QFGal4_SV40pA.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • National Institute of Genetics Limited Use Label License for Tol2 System
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry