Skip to main content

XLone-Puro Cas13d P2A eGFP-NLS
(Plasmid #155182)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155182 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Addgene #154399
  • Backbone size w/o insert (bp) 6614
  • Total vector size (bp) 9512
  • Vector type
    Mammalian Expression, Unspecified ; Piggybac transposon
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CasRx
  • Alt name
    Cas13d
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2898
  • Promoter TRE3G
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • P2A eGFP NLS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NheI, SpeI (not destroyed)
  • 5′ sequencing primer gcgcctataaaagagtgctga
  • 3′ sequencing primer M13 FWD
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The Cas13d sequence was PCR amplified from pLentiRNACRISPR_005 - hU6-DR_BsmBI-EFS-RfxCas13d-NLS-2A-Puro-WPRE, a gift from Neville Sanjana (Addgene #138147)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    XLone-Puro Cas13d P2A eGFP-NLS was a gift from Xiaoping Bao (Addgene plasmid # 155182 ; http://n2t.net/addgene:155182 ; RRID:Addgene_155182)
  • For your References section:

    Chemically-defined generation of human hemogenic endothelium and definitive hematopoietic progenitor cells. Chang Y, Syahirah R, Oprescu SN, Wang X, Jung J, Cooper SH, Torregrosa-Allen S, Elzey BD, Hsu AY, Randolph LN, Sun Y, Kuang S, Broxmeyer HE, Deng Q, Lian X, Bao X. Biomaterials. 2022 May 6;285:121569. doi: 10.1016/j.biomaterials.2022.121569. 10.1016/j.biomaterials.2022.121569 PubMed 35567999