-
Purpose(Empty Backbone) PiggybacTransposon-based tunable and temporal expression control of Cas13d- eGFP and U6 gRNA backbone
-
Depositing Lab
-
Depositing OrganizationPurdue University
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 155184 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneAddgene #155182
- Backbone size (bp) 9512
-
Vector typeMammalian Expression, Unspecified ; Piggybac transposon
- Promoter U6
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer TTTCTTGGGTAGTTTGCAGTTTT
- 3′ sequencing primer M13 RVS
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The T2A-Puro sequence was re-amplified and cloned into the backbone to remove BbsI restriction site in the T2A sequence. To clone Cas13d gRNA for gene knockdown, digest the plasmid with BbsI and then ligate annealed oligo into the backbone. gRNA could be designed using https://cas13design.nygenome.org/ and annealing oligoes should have the following format, where Ns and Ms are the gRNA sequence and its reverse-complement counterpart:
FWD:5'- AAACNNNNNNNNNNNNN
RVS: 5'-AAAAMMMMMMMMMMM
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
XLone-Puro Cas13d-eGFP U6 BbsI was a gift from Xiaoping Bao (Addgene plasmid # 155184 ; http://n2t.net/addgene:155184 ; RRID:Addgene_155184) -
For your References section:
Chemically-defined generation of human hemogenic endothelium and definitive hematopoietic progenitor cells. Chang Y, Syahirah R, Oprescu SN, Wang X, Jung J, Cooper SH, Torregrosa-Allen S, Elzey BD, Hsu AY, Randolph LN, Sun Y, Kuang S, Broxmeyer HE, Deng Q, Lian X, Bao X. Biomaterials. 2022 May 6;285:121569. doi: 10.1016/j.biomaterials.2022.121569. 10.1016/j.biomaterials.2022.121569 PubMed 35567999