Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

XLone-Puro Cas13d-eGFP U6 RUNX1 g2
(Plasmid #155186)


Item Catalog # Description Quantity Price (USD)
Plasmid 155186 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    Addgene plasmid #155184
  • Backbone size w/o insert (bp) 9817
  • Total vector size (bp) 9822
  • Vector type
    Mammalian Expression ; Piggybac transposon
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Cas13d RUNX1 gRNA2
  • gRNA/shRNA sequence
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer TTTCTTGGGTAGTTTGCAGTTTT
  • 3′ sequencing primer M13 RVS
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    XLone-Puro Cas13d-eGFP U6 RUNX1 g2 was a gift from Xiaoping Bao (Addgene plasmid # 155186 ; ; RRID:Addgene_155186)