Cas9 ROSA sgRNA mCherry
(Plasmid
#155280)
-
PurposeLentiviral Cas9 expression, ROSA sgRNA expression, mCherry marker
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 155280 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneAddgene #99154
-
Modifications to backboneInsert ROSA sgRNA at BsmB1 sites. Sequence of sgRNA is GAAGATGGGCGGGAGTCTTC with appropriate overhangs. To be used with reporter constructs 155282 and 155283
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namespCas9
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cas9 ROSA sgRNA mCherry was a gift from Martin Carroll (Addgene plasmid # 155280 ; http://n2t.net/addgene:155280 ; RRID:Addgene_155280)