Lenti sgRNA NGFR CFP out of frame
(Plasmid
#155283)
-
Purpose(Empty Backbone) Lentiviral plasmid for sgRNA, NGFR marker, editing detected with CFP, used with 155280
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 155283 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneAddgene #108098
-
Modifications to backboneCFP modified so that ATG is followed by GAAGATGGGCGGGAGTCTTC and PAM site. Attached to IRES-NGFR. CFP sequence modified to add stop in alternative CFP frame (CFP protein sequence retained). Allows tracking of edited cells by ROSA sgRNA. Used with 155280
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti sgRNA NGFR CFP out of frame was a gift from Martin Carroll (Addgene plasmid # 155283 ; http://n2t.net/addgene:155283 ; RRID:Addgene_155283)