Skip to main content
Addgene

Lenti sgRNA NGFR CFP out of frame
(Plasmid #155283)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155283 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Addgene #108098
  • Modifications to backbone
    CFP modified so that ATG is followed by GAAGATGGGCGGGAGTCTTC and PAM site. Attached to IRES-NGFR. CFP sequence modified to add stop in alternative CFP frame (CFP protein sequence retained). Allows tracking of edited cells by ROSA sgRNA. Used with 155280

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti sgRNA NGFR CFP out of frame was a gift from Martin Carroll (Addgene plasmid # 155283 ; http://n2t.net/addgene:155283 ; RRID:Addgene_155283)