eNS2B47NS3 S135A
(Plasmid
#155318)
-
PurposeDENV4 47 peptides from NS2B cofactor linked to NS3 full length by VKTQR linker S135A mutant
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 155318 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepProExHTb
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4779
- Total vector size (bp) 6806
-
Modifications to backboneNA
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDENV4 NS3 full length protein linked with 47 peptides from NS2B cofactor
-
Alt nameNS2B47NS3
-
SpeciesDengue virus 4
-
MutationS135A
-
GenBank IDJF262783 G11337
- Promoter M13
-
Tag
/ Fusion Protein
- His tag (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AGCGGATAACAATTTCACACAGG
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byProf. Subhash Vasudevan Lab, DUKE-NUS medical school, Singapore
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
original plasmid received from SV lab, flexible glycine linker GGGGSGGGG was replaced by QVKTQR NS2B-NS3 cleavage site
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eNS2B47NS3 S135A was a gift from Dahai Luo (Addgene plasmid # 155318 ; http://n2t.net/addgene:155318 ; RRID:Addgene_155318) -
For your References section:
Crystal structures of full length DENV4 NS2B-NS3 reveal the dynamic interaction between NS2B and NS3. Phoo WW, El Sahili A, Zhang Z, Chen MW, Liew CW, Lescar J, Vasudevan SG, Luo D. Antiviral Res. 2020 Oct;182:104900. doi: 10.1016/j.antiviral.2020.104900. Epub 2020 Aug 5. 10.1016/j.antiviral.2020.104900 PubMed 32763315