SZ_EC_02
(Plasmid
#155341)
-
PurposeOverexpression of xylose utilization genes of Yarrowia lipolytica using EasyCloneYALI. Cut with NotI to linearize repair fragment for C3 locus, overexpressing XK, XDH, and XR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 155341 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCfB6630
- Backbone size w/o insert (bp) 2833
- Total vector size (bp) 11624
-
Vector typeYeast Expression ; EasyCloneYALI insert vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nametef1 promoter - xylulose kinase - pex20 terminator
-
Alt nameXK
-
Alt nameYALI1_F14583g
-
Alt nameYALI0E12463p
-
SpeciesYarrowia lipolytica
-
Insert Size (bp)2360
- Promoter tef1
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ACGCAACTAACATGAATGAATACG
- 3′ sequencing primer ATCGCagagaccgggttggc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepyk1 promoter - xylose reductase - pex16 terminator
-
Alt nameXR
-
Alt nameYALI1_D09870g
-
SpeciesYarrowia lipolytica
-
Insert Size (bp)2387
- Promoter pyk1
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer aagcttcgagaagcccgaac
- 3′ sequencing primer tgcgcgcttctgttgtttgc (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namegapdh promoter - xylitol dehydrogenase - lip2 terminator
-
Alt nameXDH
-
Alt nameYALI1_E15452g
-
SpeciesYarrowia lipolytica
-
Insert Size (bp)3024
- Promoter gapdh
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer ggttgaaatgaatcggccgac
- 3′ sequencing primer ggttgaaatgaatcggccgac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that there are a few differences between the Addgene NGS result and depositor's sequence. These discrepancies do not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SZ_EC_02 was a gift from Jens Nielsen (Addgene plasmid # 155341 ; http://n2t.net/addgene:155341 ; RRID:Addgene_155341) -
For your References section:
Tolerance of Yarrowia lipolytica to inhibitors commonly found in lignocellulosic hydrolysates. Konzock O, Zaghen S, Norbeck J. BMC Microbiol. 2021 Mar 8;21(1):77. doi: 10.1186/s12866-021-02126-0. 10.1186/s12866-021-02126-0 PubMed 33685391