Skip to main content

Lentiviral human Citron shRNA 1 RFP i670
(Plasmid #155345)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155345 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Addgene #12247
  • Modifications to backbone
    iRFP670 replaces GFP Human Citron shRNA from PMID: 16431929
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Citron
  • gRNA/shRNA sequence
    ATGGAAGGCACTATTTCTCAA
  • Species
    H. sapiens (human)
  • Entrez Gene
    CIT (a.k.a. CITK, CRIK, MCPH17, STK21)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lentiviral human Citron shRNA 1 RFP i670 was a gift from Martin Carroll (Addgene plasmid # 155345 ; http://n2t.net/addgene:155345 ; RRID:Addgene_155345)