Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSNAPf-hYTHDF1-C1
(Plasmid #155349)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 155349 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSNAPf
  • Backbone manufacturer
    New England Biolabs
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    YTHDF1 (262-559)
  • Species
    H. sapiens (human)
  • GenBank ID
    CCDS13511.1
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer T7: TAATACGACTCACTATAG
  • 3′ sequencing primer pSNAPf-SeqR: GGAGTACTCACCCCAACAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSNAPf-hYTHDF1-C1 was a gift from Xiaowei Zhuang (Addgene plasmid # 155349 ; http://n2t.net/addgene:155349 ; RRID:Addgene_155349)
  • For your References section:

    m(6)A-binding YTHDF proteins promote stress granule formation. Fu Y, Zhuang X. Nat Chem Biol. 2020 May 25. pii: 10.1038/s41589-020-0524-y. doi: 10.1038/s41589-020-0524-y. 10.1038/s41589-020-0524-y PubMed 32451507