Skip to main content

pLenti-PGK-flag-RAP1B-V12-puro
(Plasmid #156168)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 156168 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti PGK Puro DEST (w529-2)
  • Backbone manufacturer
    Campeau lab (addgene #19068)
  • Backbone size w/o insert (bp) 9605
  • Total vector size (bp) 8619
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RAP1B
  • Species
    B. taurus (bovine)
  • Insert Size (bp)
    609
  • Mutation
    changed Glycine 12 to Valine
  • GenBank ID
    NM_175824
  • Entrez Gene
    RAP1B
  • Promoter human PGK
  • Tag / Fusion Protein
    • 2xFLAG (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer PGK_F (GTGTTCCGCATTCTGCAAG)
  • 3′ sequencing primer WPRE_R (CATAGCGTAAAAGGAGCAACA)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

flag-RAP1B-V12 cDNA was amplified by PCR and cloned into pENTR DTOPO and transferred by Gateway cloning into Desination vector. bioRxiv 10.1101/792077

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-PGK-flag-RAP1B-V12-puro was a gift from Roland Friedel (Addgene plasmid # 156168 ; http://n2t.net/addgene:156168 ; RRID:Addgene_156168)
  • For your References section:

    Plexin-B2 orchestrates collective stem cell dynamics via actomyosin contractility, cytoskeletal tension and adhesion. Junqueira Alves C, Dariolli R, Haydak J, Kang S, Hannah T, Wiener RJ, DeFronzo S, Tejero R, Gusella GL, Ramakrishnan A, Alves Dias R, Wojcinski A, Kesari S, Shen L, Sobie EA, Rodrigues Furtado de Mendonca JP, Azeloglu EU, Zou H, Friedel RH. Nat Commun. 2021 Oct 14;12(1):6019. doi: 10.1038/s41467-021-26296-7. 10.1038/s41467-021-26296-7 PubMed 34650052