pLenti-PGK-flag-RAP1B-N17-puro
(Plasmid
#156169)
-
PurposeLentiviral vector for expression of flag-RAP1B-N17, with puromycin selection
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 156169 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti PGK Puro DEST (w529-2)
-
Backbone manufacturerCampeau lab (addgene #19068)
- Backbone size w/o insert (bp) 9605
- Total vector size (bp) 8619
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRAP1B
-
SpeciesB. taurus (bovine)
-
Insert Size (bp)609
-
Mutationchanged Serine 17 to Asparagine
-
GenBank IDNM_175824
-
Entrez GeneRAP1B
- Promoter human PGK
-
Tag
/ Fusion Protein
- 2xFLAG (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer PGK_F (GTGTTCCGCATTCTGCAAG)
- 3′ sequencing primer WPRE_R (CATAGCGTAAAAGGAGCAACA) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byflag-RAP1B-N17 was cloned using Addgene ID #118322, Flag-Rap1b N17
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
flag-RAP1B-N17 cDNA was amplified by PCR and cloned into pENTR DTOPO and transferred by Gateway cloning into Desination vector. bioRxiv 10.1101/792077
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-PGK-flag-RAP1B-N17-puro was a gift from Roland Friedel (Addgene plasmid # 156169 ; http://n2t.net/addgene:156169 ; RRID:Addgene_156169) -
For your References section:
Plexin-B2 orchestrates collective stem cell dynamics via actomyosin contractility, cytoskeletal tension and adhesion. Junqueira Alves C, Dariolli R, Haydak J, Kang S, Hannah T, Wiener RJ, DeFronzo S, Tejero R, Gusella GL, Ramakrishnan A, Alves Dias R, Wojcinski A, Kesari S, Shen L, Sobie EA, Rodrigues Furtado de Mendonca JP, Azeloglu EU, Zou H, Friedel RH. Nat Commun. 2021 Oct 14;12(1):6019. doi: 10.1038/s41467-021-26296-7. 10.1038/s41467-021-26296-7 PubMed 34650052