Skip to main content

S4246
(Bacterial strain #156372)

Full plasmid sequence is not available for this item.

No maps are available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Bacterial Strain 156372 Bacteria in agar stab 1 $89

Backbone

  • Vector backbone
    N/A
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Streptomycin, Tetracycline, Erythromycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    S4246
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    None

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For this strain the depositor have verified the appropriate antibiotic resistances, validated sequencing of relevant regions, and performed a restriction enzyme digest to confirm the expected cut sites

Depositor recomments the following primers to sequence the relevant regions:
gaaattccttgtcgggtaagttcc
gaacatcaaacattaaagggtggtatttc

Depositor also recommends testing for antibiotic resistance alongside the sequencing and digestion verification.
Protocol for the digestion reaction:
For 50 uL reaction:
1 ug DNA
5 uL CutSmart
1 uL HpyCH4III
Up to 50 uL MQ water
Depositor confirmed that the resulting bands were confirmed to be shorter than the starting template

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    S4246 was a gift from Ahmed Badran (Addgene plasmid # 156372)
  • For your References section:

    Orthogonal translation enables heterologous ribosome engineering in E. coli. Kolber NS, Fattal R, Bratulic S, Carver GD, Badran AH. Nat Commun. 2021 Jan 26;12(1):599. doi: 10.1038/s41467-020-20759-z. 10.1038/s41467-020-20759-z PubMed 33500394