S4246
(Bacterial strain
#156372)
-
PurposeErythromycin-resistant S2060 derivative
-
Depositing Lab
-
Sequence Information
-
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Bacterial Strain | 156372 | Bacteria in agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneN/A
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Streptomycin, Tetracycline, Erythromycin
-
Growth Temperature37°C
-
Growth Strain(s)S4246
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNone
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For this strain the depositor have verified the appropriate antibiotic resistances, validated sequencing of relevant regions, and performed a restriction enzyme digest to confirm the expected cut sites
Depositor recomments the following primers to sequence the relevant regions:
gaaattccttgtcgggtaagttcc
gaacatcaaacattaaagggtggtatttc
Depositor also recommends testing for antibiotic resistance alongside the sequencing and digestion verification.
Protocol for the digestion reaction:
For 50 uL reaction:
1 ug DNA
5 uL CutSmart
1 uL HpyCH4III
Up to 50 uL MQ water
Depositor confirmed that the resulting bands were confirmed to be shorter than the starting template
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
S4246 was a gift from Ahmed Badran (Addgene plasmid # 156372) -
For your References section:
Orthogonal translation enables heterologous ribosome engineering in E. coli. Kolber NS, Fattal R, Bratulic S, Carver GD, Badran AH. Nat Commun. 2021 Jan 26;12(1):599. doi: 10.1038/s41467-020-20759-z. 10.1038/s41467-020-20759-z PubMed 33500394