S4246
(Bacterial strain #156372)

• Purpose: Erythromycin-resistant S2060 derivative
• Depositing Lab: Ahmed Badran
• Publication: Kolber et al Nat Commun. 2021 Jan 26;12(1):599. doi: 10.1038/s41467-020-20759-z.

Backbone

• Vector backbone: N/A
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Streptomycin, Tetracycline, Erythromycin
• Growth Temperature: 37°C
• Growth Strain(s): S4246
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: None

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For this strain the depositor have verified the appropriate antibiotic resistances, validated sequencing of relevant regions, and performed a restriction enzyme digest to confirm the expected cut sites

Depositor recomments the following primers to sequence the relevant regions:
gaaattccttgtcgggtaagttcc
gaacatcaaacattaaagggtggtatttc

Depositor also recommends testing for antibiotic resistance alongside the sequencing and digestion verification.
Protocol for the digestion reaction:
For 50 uL reaction:
1 ug DNA
5 uL CutSmart
1 uL HpyCH4III
Up to 50 uL MQ water
Depositor confirmed that the resulting bands were confirmed to be shorter than the starting template