Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

(Plasmid #156485)


Item Catalog # Description Quantity Price (USD)
Plasmid 156485 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Growth in BL21 DE3 gold 37˚C after induction with 1mM 16hours 18˚C
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    Synthetic; Severe acute respiratory syndrome coronavirus 2
  • Mutation
    Gene insert is codon optimized for Ecoli.
  • Promoter T7/LacO
  • Tag / Fusion Protein
    • His-GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nco1 (destroyed during cloning)
  • 3′ cloning site EcoR1 (destroyed during cloning)
  • 5′ sequencing primer CGGATCTGGAAGTTCTGTTCC
  • 3′ sequencing primer GAGTGCGGCCGCAAGCTTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.

Depositor Comments


How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pETM33_Orf9b was a gift from Ylva Ivarsson (Addgene plasmid # 156485 ; ; RRID:Addgene_156485)