Skip to main content

pDendra2-H2b
(Plasmid #157817)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 157817 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Dendra2-N1
  • Backbone size w/o insert (bp) 4750
  • Total vector size (bp) 5087
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Histone H2B
  • Alt name
    Hist1h2bb
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    378
  • GenBank ID
    319178
  • Entrez Gene
    H2bc3 (a.k.a. H2b-143, Hist1h2bb)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer N/A
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDendra2-H2b was a gift from Xin Chen (Addgene plasmid # 157817 ; http://n2t.net/addgene:157817 ; RRID:Addgene_157817)
  • For your References section:

    Differential Histone Distribution Patterns in Induced Asymmetrically Dividing Mouse Embryonic Stem Cells. Ma B, Trieu TJ, Cheng J, Zhou S, Tang Q, Xie J, Liu JL, Zhao K, Habib SJ, Chen X. Cell Rep. 2020 Aug 11;32(6):108003. doi: 10.1016/j.celrep.2020.108003. 10.1016/j.celrep.2020.108003 PubMed 32783931