pD451-pA-APEX2
(Plasmid
#157863)
-
PurposeBacterial expression plasmid to express pA-APEX2 for antibody-based biotin proximity labeling
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 157863 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepD451
-
Backbone manufacturerATUM
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepA-APEX2
-
SpeciesSynthetic
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAACGTAAAAACCCGCTTCG
- 3′ sequencing primer GGCTTTCGTTCAGCTTTTTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byATUM
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pD451-pA-APEX2 was a gift from Alex Kentsis (Addgene plasmid # 157863 ; http://n2t.net/addgene:157863 ; RRID:Addgene_157863)