Skip to main content

pPK-351
(Plasmid #157921)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 157921 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Vector type
    Mammalian Expression, Synthetic Biology ; Optogenetics

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH10B
  • Growth instructions
    This plasmid can grow slowly and have low yields but is more stable than pPK-230.
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    PIF3-MTAD
  • Species
    H. sapiens (human), A. thaliana (mustard weed)
  • Insert Size (bp)
    701
  • Mutation
    pif3 1-523
  • Promoter CMV
  • Tag / Fusion Protein
    • SV40NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    IRES
  • Alt name
    Internal Ribosomal Entry Site
  • Insert Size (bp)
    583

Gene/Insert 3

  • Gene/Insert name
    PhyB(1-621)-SV40NLS-Gal4DBD
  • Species
    S. cerevisiae (budding yeast), A. thaliana (mustard weed)
  • Insert Size (bp)
    2391
  • Tag / Fusion Protein
    • HA tag (C terminal on insert)

Cloning Information for Gene/Insert 3

  • Cloning method Unknown
  • 5′ sequencing primer GACGTGGTTTTCCTTTGAAAAACAC
  • 3′ sequencing primer SP6 promoter
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPK-351 was a gift from Phillip Kyriakakis (Addgene plasmid # 157921 ; http://n2t.net/addgene:157921 ; RRID:Addgene_157921)
  • For your References section:

    Building a Simple and Versatile Illumination System for Optogenetic Experiments. Kyriakakis P, Fernandez de Cossio L, Howard PW, Kouv S, Catanho M, Hu VJ, Kyriakakis R, Allen ME, Ma Y, Aguilar-Rivera M, Coleman TP. J Vis Exp. 2021 Jan 12;(167). doi: 10.3791/61914. 10.3791/61914 PubMed 33522514