Skip to main content

pLL3.7-Rictor-shRNA
(Plasmid #157930)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 157930 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLL3.7
  • Backbone size w/o insert (bp) 7650
  • Vector type
    Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Rictor shRNA
  • gRNA/shRNA sequence
    GCCAGTAAGATGGGAATCATT
  • Species
    M. musculus (mouse)
  • Promoter mouse U6
  • Tag / Fusion Protein
    • tdTomato

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (destroyed during cloning)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer U6 (5'-cagtgcaggggaaagaatagtagac-3')
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLL3.7-Rictor-shRNA was a gift from Baoji Xu (Addgene plasmid # 157930 ; http://n2t.net/addgene:157930 ; RRID:Addgene_157930)
  • For your References section:

    Caspase-2 promotes AMPA receptor internalization and cognitive flexibility via mTORC2-AKT-GSK3beta signaling. Xu ZX, Tan JW, Xu H, Hill CJ, Ostrovskaya O, Martemyanov KA, Xu B. Nat Commun. 2019 Aug 9;10(1):3622. doi: 10.1038/s41467-019-11575-1. 10.1038/s41467-019-11575-1 PubMed 31399584