pLL3.7-Rictor-shRNA
(Plasmid
#157930)
-
PurposeKnockdown of Rictor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 157930 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLL3.7
- Backbone size w/o insert (bp) 7650
-
Vector typeLentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRictor shRNA
-
gRNA/shRNA sequenceGCCAGTAAGATGGGAATCATT
-
SpeciesM. musculus (mouse)
- Promoter mouse U6
-
Tag
/ Fusion Protein
- tdTomato
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (destroyed during cloning)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer U6 (5'-cagtgcaggggaaagaatagtagac-3') (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLL3.7-Rictor-shRNA was a gift from Baoji Xu (Addgene plasmid # 157930 ; http://n2t.net/addgene:157930 ; RRID:Addgene_157930) -
For your References section:
Caspase-2 promotes AMPA receptor internalization and cognitive flexibility via mTORC2-AKT-GSK3beta signaling. Xu ZX, Tan JW, Xu H, Hill CJ, Ostrovskaya O, Martemyanov KA, Xu B. Nat Commun. 2019 Aug 9;10(1):3622. doi: 10.1038/s41467-019-11575-1. 10.1038/s41467-019-11575-1 PubMed 31399584