pCaggs-NLS-PAmCherry1-GSS-EGFP
(Plasmid
#158000)
-
PurposeExpression of nucleus localized PAmCherry1 and EGFP fusion protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 158000 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCaggs
- Backbone size w/o insert (bp) 6105
- Total vector size (bp) 7584
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS-PAmCherry1-GSS-EGFP
-
SpeciesSynthetic
-
Insert Size (bp)1479
- Promoter Actin promoter with CMV enhancer
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer aaggtggtggctggtgtggc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PAmCherry1: FPBaseID OMODZ
EGFP: FPBaseID R9NL8
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCaggs-NLS-PAmCherry1-GSS-EGFP was a gift from Francois St-Pierre (Addgene plasmid # 158000 ; http://n2t.net/addgene:158000 ; RRID:Addgene_158000) -
For your References section:
Versatile phenotype-activated cell sorting. Lee J, Liu Z, Suzuki PH, Ahrens JF, Lai S, Lu X, Guan S, St-Pierre F. Sci Adv. 2020 Oct 23;6(43). pii: 6/43/eabb7438. doi: 10.1126/sciadv.abb7438. Print 2020 Oct. 10.1126/sciadv.abb7438 PubMed 33097540