pDEST-hSTARR-luc-Pmyc-ccw
(Plasmid
#158027)
-
Purpose(Empty Backbone) This is a dual function destination vector for eSTARR-seq and luciferase assay to quantify enhancer activity. It contains a MYC promoter, a luciferase CDS, followed by a Gateway cassette (R2-R1).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158027 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSTARR-seq_human
- Backbone size (bp) 5110
-
Modifications to backboneSubstituted SCP1 promoter, sgGFP, and LIC site with MYC promoter, luc2 CDS, and a Gateway cassette (R2-R1) respectively
-
Vector typeMammalian Expression, Luciferase
- Promoter MYC
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer AGATCCGCGAGATTCTCATTAAG
- 3′ sequencing primer GTGGTTTGTCCAAACTCATCAA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDEST-hSTARR-luc-Pmyc-ccw was a gift from Haiyuan Yu (Addgene plasmid # 158027 ; http://n2t.net/addgene:158027 ; RRID:Addgene_158027) -
For your References section:
Transcription imparts architecture, function and logic to enhancer units. Tippens ND, Liang J, Leung AK, Wierbowski SD, Ozer A, Booth JG, Lis JT, Yu H. Nat Genet. 2020 Oct;52(10):1067-1075. doi: 10.1038/s41588-020-0686-2. Epub 2020 Sep 21. 10.1038/s41588-020-0686-2 PubMed 32958950