Skip to main content

pDEST-hSTARR-luc
(Plasmid #158028)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158028 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSTARR-seq_human
  • Backbone size (bp) 5110
  • Vector type
    Mammalian Expression, Luciferase
  • Promoter SCP1 (Super Core Promoter 1)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer AGATCCGCGAGATTCTCATTAAG
  • 3′ sequencing primer GTGGTTTGTCCAAACTCATCAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDEST-hSTARR-luc was a gift from Haiyuan Yu (Addgene plasmid # 158028 ; http://n2t.net/addgene:158028 ; RRID:Addgene_158028)
  • For your References section:

    Transcription imparts architecture, function and logic to enhancer units. Tippens ND, Liang J, Leung AK, Wierbowski SD, Ozer A, Booth JG, Lis JT, Yu H. Nat Genet. 2020 Oct;52(10):1067-1075. doi: 10.1038/s41588-020-0686-2. Epub 2020 Sep 21. 10.1038/s41588-020-0686-2 PubMed 32958950