pSpCas9_mouse_Adar2_ccB
(Plasmid
#158119)
-
Purposedeletion mADAR2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 158119 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro PX459
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 9175
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAdar2
-
gRNA/shRNA sequenceCACC G ACATGACGAAGCTCTTGGCG
-
SpeciesM. musculus (mouse)
-
GenBank ID110532
-
Entrez GeneAdarb1 (a.k.a. 1700057H01Rik, AW124433, AW558573, Adar2, BB220382, D10Bwg0447e, Red1)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.07.12.499727 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCas9_mouse_Adar2_ccB was a gift from Emanuela Felley-Bosco (Addgene plasmid # 158119 ; http://n2t.net/addgene:158119 ; RRID:Addgene_158119) -
For your References section:
Heterogeneous RNA editing and influence of ADAR2 on mesothelioma chemoresistance and the tumor microenvironment. Hariharan A, Qi W, Rehrauer H, Wu L, Ronner M, Wipplinger M, Kresoja-Rakic J, Sun S, Oton-Gonzalez L, Sculco M, Serre-Beinier V, Meiller C, Blanquart C, Fonteneau JF, Vrugt B, Ruschoff JH, Opitz I, Jean D, de Perrot M, Felley-Bosco E. Mol Oncol. 2022 Dec;16(22):3949-3974. doi: 10.1002/1878-0261.13322. Epub 2022 Oct 31. 10.1002/1878-0261.13322 PubMed 36221913