Ef1a-QCP-3xBFP
(Plasmid
#158206)
-
PurposeQb coat protein fused to three repeats of the blue fluorescent protein under a Efla promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158206 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAddgene number 75384
-
Modifications to backboneInstead of the MS2 coat protein we inserted a QB coat protein sequence.
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameQCP under the Elfa promoter and three BFP tags
-
SpeciesSynthetic
- Promoter Elfa
-
Tag
/ Fusion Protein
- 3xBFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CGCCGTGAACGTTCTTTTTCGCAACG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene NGS result found different linkers between the BFP's when compared to the backbone #75384. The depositor confirmed they observed strong BFP fluorescence and the different linkers are not a concern.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Ef1a-QCP-3xBFP was a gift from Roee Amit (Addgene plasmid # 158206 ; http://n2t.net/addgene:158206 ; RRID:Addgene_158206) -
For your References section:
Overcoming the design, build, test bottleneck for synthesis of nonrepetitive protein-RNA cassettes. Katz N, Tripto E, Granik N, Goldberg S, Atar O, Yakhini Z, Orenstein Y, Amit R. Nat Commun. 2021 Mar 11;12(1):1576. doi: 10.1038/s41467-021-21578-6. 10.1038/s41467-021-21578-6 PubMed 33707432