Skip to main content

Ef1a-QCP-3xBFP
(Plasmid #158206)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158206 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Addgene number 75384
  • Modifications to backbone
    Instead of the MS2 coat protein we inserted a QB coat protein sequence.
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    QCP under the Elfa promoter and three BFP tags
  • Species
    Synthetic
  • Promoter Elfa
  • Tag / Fusion Protein
    • 3xBFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CGCCGTGAACGTTCTTTTTCGCAACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene NGS result found different linkers between the BFP's when compared to the backbone #75384. The depositor confirmed they observed strong BFP fluorescence and the different linkers are not a concern.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Ef1a-QCP-3xBFP was a gift from Roee Amit (Addgene plasmid # 158206 ; http://n2t.net/addgene:158206 ; RRID:Addgene_158206)
  • For your References section:

    Overcoming the design, build, test bottleneck for synthesis of nonrepetitive protein-RNA cassettes. Katz N, Tripto E, Granik N, Goldberg S, Atar O, Yakhini Z, Orenstein Y, Amit R. Nat Commun. 2021 Mar 11;12(1):1576. doi: 10.1038/s41467-021-21578-6. 10.1038/s41467-021-21578-6 PubMed 33707432
Commonly requested with: