-
PurposeBRET-based reporter to enable pan-extracellular particle labelling ranging from exomeres (< 50 nm) to small (< 200 nm; e.g. exosomes) and medium and large (> 200 nm; e.g. microvesicles) EVs.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158221 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti CMV Puro DEST (w118-1)
- Backbone size w/o insert (bp) 7973
- Total vector size (bp) 9292
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructions32-degree Celsius for 16-18 hours
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePalmGFP-Nluc
-
SpeciesSynthetic
-
Insert Size (bp)1309
- Promoter CMV
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGGTGGGAGGTCTATATAAGCAG
- 3′ sequencing primer CATACGGGAAGCAATAGCATGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene plasmid # 70185
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-PalmGRET was a gift from Charles P. Lai (Addgene plasmid # 158221 ; http://n2t.net/addgene:158221 ; RRID:Addgene_158221) -
For your References section:
Multiresolution Imaging Using Bioluminescence Resonance Energy Transfer Identifies Distinct Biodistribution Profiles of Extracellular Vesicles and Exomeres with Redirected Tropism. Wu AY, Sung YC, Chen YJ, Chou ST, Guo V, Chien JC, Ko JJ, Yang AL, Huang HC, Chuang JC, Wu S, Ho MR, Ericsson M, Lin WW, Cheung CHY, Juan HF, Ueda K, Chen Y, Lai CP. Adv Sci (Weinh). 2020 Aug 16;7(19):2001467. doi: 10.1002/advs.202001467. eCollection 2020 Oct. 10.1002/advs.202001467 PubMed 33042758