Skip to main content

sgRNA targeting human SLC12A5 gene stop codon
(Plasmid #158577)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158577 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Cas9-PolyA-CMV-GFP
  • Backbone size w/o insert (bp) 9300
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting human SLC12A5 gene stop codon
  • gRNA/shRNA sequence
    ACCATCTACTCCTGAGAACC
  • Species
    H. sapiens (human)
  • Tag / Fusion Protein
    • Cas9 and GFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer pLKO
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgRNA targeting human SLC12A5 gene stop codon was a gift from Rudolf Jaenisch (Addgene plasmid # 158577 ; http://n2t.net/addgene:158577 ; RRID:Addgene_158577)
  • For your References section:

    Pharmacological enhancement of KCC2 gene expression exerts therapeutic effects on human Rett syndrome neurons and Mecp2 mutant mice. Tang X, Drotar J, Li K, Clairmont CD, Brumm AS, Sullins AJ, Wu H, Liu XS, Wang J, Gray NS, Sur M, Jaenisch R. Sci Transl Med. 2019 Jul 31;11(503). pii: 11/503/eaau0164. doi: 10.1126/scitranslmed.aau0164. 10.1126/scitranslmed.aau0164 PubMed 31366578