Skip to main content

pRS423-GPD-wrmScarlet1-10-CYC1 terminator
(Plasmid #158584)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158584 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRS423
  • Backbone size w/o insert (bp) 6682
  • Total vector size (bp) 7306
  • Vector type
    Yeast Expression
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    wrmScarlet1-10
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    624
  • Promoter GPD

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gacggtaggtattgattgtaattctg
  • 3′ sequencing primer ggcgtgaatgtaagcgtgac
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    gene synthesis

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS423-GPD-wrmScarlet1-10-CYC1 terminator was a gift from Cynthia Kenyon (Addgene plasmid # 158584 ; http://n2t.net/addgene:158584 ; RRID:Addgene_158584)
  • For your References section:

    Split-wrmScarlet and split-sfGFP: tools for faster, easier fluorescent labeling of endogenous proteins in Caenorhabditis elegans. Goudeau J, Sharp CS, Paw J, Savy L, Leonetti MD, York AG, Updike DL, Kenyon C, Ingaramo M. Genetics. 2021 Apr 15;217(4). pii: 6126424. doi: 10.1093/genetics/iyab014. 10.1093/genetics/iyab014 PubMed 33693628