pCDF-pntAB
(Plasmid
#158609)
-
PurposeLow phosphate induction of pntAB
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158609 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDF
- Backbone size w/o insert (bp) 2060
- Total vector size (bp) 5287
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepntAB(membrane bound proton translocating pyridine nucleotide transhydrogenase)
-
SpeciesSynthetic
- Promoter Insulated ugpBp from E. coli
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGTCCAGTTACGCTGGAGTC
- 3′ sequencing primer GGTCAGGTATGATTTAAATGGTCAGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Read the preprint at bioRxiv: https://doi.org/10.1101/2020.07.27.222588
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDF-pntAB was a gift from Michael Lynch (Addgene plasmid # 158609 ; http://n2t.net/addgene:158609 ; RRID:Addgene_158609) -
For your References section:
Dynamic control over feedback regulatory mechanisms improves NADPH flux and xylitol biosynthesis in engineered E. coli. Li S, Ye Z, Moreb EA, Hennigan JN, Castellanos DB, Yang T, Lynch MD. Metab Eng. 2021 Jan 15. pii: S1096-7176(21)00013-6. doi: 10.1016/j.ymben.2021.01.005. 10.1016/j.ymben.2021.01.005 PubMed 33460820