Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCDF-pntAB
(Plasmid #158609)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 158609 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCDF
  • Backbone size w/o insert (bp) 2060
  • Total vector size (bp) 5287
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pntAB(membrane bound proton translocating pyridine nucleotide transhydrogenase)
  • Species
    Synthetic
  • Promoter Insulated ugpBp from E. coli

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAGTCCAGTTACGCTGGAGTC
  • 3′ sequencing primer GGTCAGGTATGATTTAAATGGTCAGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Read the preprint at bioRxiv: https://doi.org/10.1101/2020.07.27.222588

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDF-pntAB was a gift from Michael Lynch (Addgene plasmid # 158609 ; http://n2t.net/addgene:158609 ; RRID:Addgene_158609)
  • For your References section:

    Dynamic control over feedback regulatory mechanisms improves NADPH flux and xylitol biosynthesis in engineered E. coli. Li S, Ye Z, Moreb EA, Hennigan JN, Castellanos DB, Yang T, Lynch MD. Metab Eng. 2021 Jan 15. pii: S1096-7176(21)00013-6. doi: 10.1016/j.ymben.2021.01.005. 10.1016/j.ymben.2021.01.005 PubMed 33460820