Skip to main content

pSWD55
(Plasmid #158618)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158618 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pXCFPC-6
  • Backbone size w/o insert (bp) 4828
  • Total vector size (bp) 6461
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Short FRET Standard
  • Alt name
    mClover3-Fibronectin Unit 10-mRuby3
  • Species
    Synthetic
  • Insert Size (bp)
    1701
  • Promoter Xylose

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCCACATGTTAGCGCTACCAAGTGC
  • 3′ sequencing primer GCCAGGGTTTTCCCAGTCACGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Vector from Martin Thanbichler PM ID 17959646 "A comprehensive set of plasmids for vanillate- and xylose-inducible gene expression in Caulobacter crescentus".

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSWD55 was a gift from Seth Childers (Addgene plasmid # 158618 ; http://n2t.net/addgene:158618 ; RRID:Addgene_158618)
  • For your References section:

    Design of a Histidine Kinase FRET Sensor to Detect Complex Signal Integration within Living Bacteria. Duvall SW, Childers WS. ACS Sens. 2020 Jun 26;5(6):1589-1596. doi: 10.1021/acssensors.0c00008. Epub 2020 Jun 16. 10.1021/acssensors.0c00008 PubMed 32495620