pet11a-ABLE
(Plasmid
#158627)
-
PurposeAmp resistant IPTG inducible 6xHis-TEV-ABLE protein for E. coli expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158627 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepet11a
-
Backbone manufacturergenscript
- Backbone size w/o insert (bp) 5641
- Total vector size (bp) 6061
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameApixaban-Binding Helical Bundle
-
Alt nameABLE
-
SpeciesSynthetic
-
Insert Size (bp)420
- Promoter T7
-
Tag
/ Fusion Protein
- 6x His-tag and TEV cleavage tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGenScript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pet11a-ABLE was a gift from William DeGrado (Addgene plasmid # 158627 ; http://n2t.net/addgene:158627 ; RRID:Addgene_158627) -
For your References section:
A defined structural unit enables de novo design of small-molecule-binding proteins. Polizzi NF, DeGrado WF. Science. 2020 Sep 4;369(6508):1227-1233. doi: 10.1126/science.abb8330. 10.1126/science.abb8330 PubMed 32883865