pLKO.1 shSV40 neo
(Plasmid
#158646)
-
PurposeLentiviral shRNA vector targeting simian virus 40 T antigen (SV40Tag)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 158646 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLKO.1 neo
-
Backbone manufacturerAddgene #13425
-
Vector typeLentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSV40Tag
-
gRNA/shRNA sequenceGCATAGAGTGTCTGCTATTAA
-
SpeciesSimian virus 40
-
Entrez GeneSV40gp6 (a.k.a. SV40gp6)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1 shSV40 neo was a gift from Kevin Janes (Addgene plasmid # 158646 ; http://n2t.net/addgene:158646 ; RRID:Addgene_158646) -
For your References section:
Modeling the complete kinetics of coxsackievirus B3 reveals human determinants of host-cell feedback. Lopacinski AB, Sweatt AJ, Smolko CM, Gray-Gaillard E, Borgman CA, Shah M, Janes KA. Cell Syst. 2021 Apr 21;12(4):304-323.e13. doi: 10.1016/j.cels.2021.02.004. Epub 2021 Mar 18. 10.1016/j.cels.2021.02.004 PubMed 33740397