Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pMSR:MSMEG_0034:Dendra
(Plasmid #158999)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 158999 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMSR:Dendra
  • Vector type
    Bacterial Expression ; Integrating Mycobacterial Expression Vector attL5

Growth in Bacteria

  • Bacterial Resistance(s)
    Apramycin, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MSMEG_0034
  • Species
    M. smegmatis
  • Promoter pmycTetO
  • Tag / Fusion Protein
    • Gly-Ala Linker/Dendra2/1x Flag Tag (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TGATAGAGTTTGTCCTCCCTATCAG
  • 3′ sequencing primer TCCATATGCACCTTGACACG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

NCBI reference sequence: CP000480.1. 5' cloning site: Ase1, destroyed during cloning. 3' cloning site: HindIII, not destroyed during cloning

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSR:MSMEG_0034:Dendra was a gift from Keith Derbyshire & Joseph Wade (Addgene plasmid # 158999 ; http://n2t.net/addgene:158999 ; RRID:Addgene_158999)
  • For your References section:

    A Mycobacterial Systems Resource for the Research Community. Judd JA, Canestrari J, Clark R, Joseph A, Lapierre P, Lasek-Nesselquist E, Mir M, Palumbo M, Smith C, Stone M, Upadhyay A, Wirth SE, Dedrick RM, Meier CG, Russell DA, Dills A, Dove E, Kester J, Wolf ID, Zhu J, Rubin ER, Fortune S, Hatfull GF, Gray TA, Wade JT, Derbyshire KM. mBio. 2021 Mar 2;12(2). pii: mBio.02401-20. doi: 10.1128/mBio.02401-20. 10.1128/mBio.02401-20 PubMed 33653882