pDECKO_mCherry_AAVS1_1801
(Plasmid
#159090)
-
Purposetargeting, non-essential locus control
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159090 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDECKO_GFP
- Backbone size w/o insert (bp) 10965
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA
-
gRNA/shRNA sequencetargets the intron of the AAVS1 gene, 1:GAGTGCCCTTGCTGTGCCGC 2:CCTCTGGGGGATGCAGGGGA
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer Unknown
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
derivative of Addgene plasmid #78534
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDECKO_mCherry_AAVS1_1801 was a gift from Rory Johnson (Addgene plasmid # 159090 ; http://n2t.net/addgene:159090 ; RRID:Addgene_159090) -
For your References section:
Multi-hallmark long noncoding RNA maps reveal non-small cell lung cancer vulnerabilities. Esposito R, Polidori T, Meise DF, Pulido-Quetglas C, Chouvardas P, Forster S, Schaerer P, Kobel A, Schlatter J, Kerkhof E, Roemmele M, Rice ES, Zhu L, Lanzos A, Guillen-Ramirez HA, Basile G, Carrozzo I, Vancura A, Ullrich S, Andrades A, Harvey D, Medina PP, Ma PC, Haefliger S, Wang X, Martinez I, Ochsenbein AF, Riether C, Johnson R. Cell Genom. 2022 Aug 22;2(9):100171. doi: 10.1016/j.xgen.2022.100171. eCollection 2022 Sep 14. 10.1016/j.xgen.2022.100171 PubMed 36778670