Skip to main content

p35S::SP-mCherry-GFP-HDEL
(Plasmid #159097)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159097 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pB7FWG2
  • Backbone manufacturer
    Ghent
  • Backbone size w/o insert (bp) 11628
  • Total vector size (bp) 11495
  • Modifications to backbone
    Introduction of SP-mCherry-GFP-HDEL for FRET positive control
  • Vector type
    Plant Expression
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SP-mCherry-GFP-HDEL
  • Species
    Synthetic
  • Insert Size (bp)
    1528
  • Promoter 35S
  • Tag / Fusion Protein
    • mCherry, GFP

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ctgttccacgatggtgtagtcc
  • 3′ sequencing primer ctgttccacgatggtgtagtcc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene QC NGS and diagnostic digest data shows a larger than expected plasmid sequence, relative to the sequence provided by the depositing laboratory, including a potential duplication of the insert sequence.

This construct is used as an positive control for apFRET in the ER or outer nuclear envelope in plant cells. The mCherry and GFP are fused by a GGSGG amino acid linker.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p35S::SP-mCherry-GFP-HDEL was a gift from Joe McKenna (Addgene plasmid # 159097 ; http://n2t.net/addgene:159097 ; RRID:Addgene_159097)
  • For your References section:

    Maize (Zea mays L.) Nucleoskeletal Proteins Regulate Nuclear Envelope Remodeling and Function in Stomatal Complex Development and Pollen Viability. McKenna JF, Gumber HK, Turpin ZM, Jalovec AM, Kartick AC, Graumann K, Bass HW. Front Plant Sci. 2021 Feb 17;12:645218. doi: 10.3389/fpls.2021.645218. eCollection 2021. 10.3389/fpls.2021.645218 PubMed 33679862