pHOT-P2Y2R
(Plasmid
#159108)
-
Purposeentiviral vector encoding P2Y purinoceptor 2 (P2Y2R), a high affinity G-protein coupled receptor that mobilizes Ca2+ from intracellular stores upon binding extracellular ATP.48,49 By using the Gibson
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159108 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepultra-hot
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameP2Y2R
-
SpeciesH. sapiens (human)
- Promoter UBC
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCAGGTGCCATTGATGGTGTCATT
- 3′ sequencing primer TAGAAGATGTGTTGGGCAGCAGTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byP2Y2R complementary DNA was a gift of Dr. Marta Fumagalli, University of Milan, Department of Pharmacological and Biomolecular Sciences, Laboratory of Molecular and Cellular Pharmacology of Purinergic Transmission. Address: Via Balzaretti, 9/11/13 - 20133 MILANO (MI), Italy.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHOT-P2Y2R was a gift from Fabio Mammano (Addgene plasmid # 159108 ; http://n2t.net/addgene:159108 ; RRID:Addgene_159108) -
For your References section:
Organ-on-chip model shows that ATP release through connexin hemichannels drives spontaneous Ca(2+) signaling in non-sensory cells of the greater epithelial ridge in the developing cochlea. Mazzarda F, D'Elia A, Massari R, De Ninno A, Bertani FR, Businaro L, Ziraldo G, Zorzi V, Nardin C, Peres C, Chiani F, Tettey-Matey A, Raspa M, Scavizzi F, Soluri A, Salvatore AM, Yang J, Mammano F. Lab Chip. 2020 Jul 23. doi: 10.1039/d0lc00427h. 10.1039/d0lc00427h PubMed 32700707