pHOT-P2Y2R
(Plasmid #159108)

• Purpose: entiviral vector encoding P2Y purinoceptor 2 (P2Y2R), a high affinity G-protein coupled receptor that mobilizes Ca2+ from intracellular stores upon binding extracellular ATP.48,49 By using the Gibson
• Depositing Lab: Fabio Mammano
• Publication: Mazzarda et al Lab Chip. 2020 Jul 23. doi: 10.1039/d0lc00427h.

Backbone

• Vector backbone: pultra-hot
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: P2Y2R
• Species: H. sapiens (human)
• Promoter: UBC

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCAGGTGCCATTGATGGTGTCATT
• 3′ sequencing primer: TAGAAGATGTGTTGGGCAGCAGTG

Resource Information

• Supplemental Documents:
  • phot_p2y2.gb
• A portion of this plasmid was derived from a plasmid made by: P2Y2R complementary DNA was a gift of Dr. Marta Fumagalli, University of Milan, Department of Pharmacological and Biomolecular Sciences, Laboratory of Molecular and Cellular Pharmacology of Purinergic Transmission. Address: Via Balzaretti, 9/11/13 - 20133 MILANO (MI), Italy.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry